View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_61 (Length: 328)
Name: NF1371_low_61
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 231
Target Start/End: Complemental strand, 2155767 - 2155555
Alignment:
| Q |
20 |
aatatttcatcattctttaattaattaatagtttatccctaacaagccaaactaagcacttagcttttgattatttaattaattggtttattctc-tcct |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2155767 |
aatatttcatcattctttaatttattaatagtttatccctaacaagccaaactaagtacttagcttttgattatttaattaattggtttattctcatcct |
2155668 |
T |
 |
| Q |
119 |
ccttaattaaggttaaaggtcagagattaaatgacagagttgaagttgttaccctaaagccatgtctactaagaatggttgaaggtaggtgtagttagta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2155667 |
ccttaattaaggttaaaggtcagagattaaatgacagagttgaagttgttaccctaaagccatgtctactaagaatggttgaaggtaggtgtagttagta |
2155568 |
T |
 |
| Q |
219 |
tatctgtttattc |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2155567 |
tatctgtttattc |
2155555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University