View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_65 (Length: 317)
Name: NF1371_low_65
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 9e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 44448758 - 44448823
Alignment:
| Q |
11 |
taattctctctgaagtaacattatttatttaatctctcctaaagaaatatttgcttgattataaac |
76 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44448758 |
taattctctctaaagtaacattatttatttaatctctcctaaagaaatatttgcttgattataaac |
44448823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 44448869 - 44448989
Alignment:
| Q |
122 |
tcataattgaatgatgtgtgttaaacattgtactgttgacannnnnnnatgcaattgagcctaaagatacttagacatcta-nnnnnnnnacatacacat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
44448869 |
tcataattgaatgatgtgtgttaaacattgtattgttgaca-ttttttatacaattgagcctaaagatatttagacatctattttttttaacgtacacat |
44448967 |
T |
 |
| Q |
221 |
gcaacatttgatcaatcacatt |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44448968 |
gcaacatttgatcaatcacatt |
44448989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 310
Target Start/End: Complemental strand, 42764393 - 42764364
Alignment:
| Q |
281 |
gacaagcttaactgtgtggtctctgtggtg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42764393 |
gacaagcttaactgtgtggtctctgtggtg |
42764364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 310
Target Start/End: Complemental strand, 33050367 - 33050338
Alignment:
| Q |
281 |
gacaagcttaactgtgtggtctctgtggtg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33050367 |
gacaagcttaactgtgtggtctctgtggtg |
33050338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University