View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_low_68 (Length: 306)

Name: NF1371_low_68
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_low_68
NF1371_low_68
[»] chr7 (2 HSPs)
chr7 (82-295)||(3106092-3106305)
chr7 (30-65)||(3105906-3105941)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 82 - 295
Target Start/End: Original strand, 3106092 - 3106305
Alignment:
82 ttaatgattattgattgtccgattgagatcatataatttaaagttcaaagtcgataattttagttttgaaaaaattaaaataaactttttctttataact 181  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
3106092 ttaatgattattgattgtctgattgagatcatataatttaaagttcaaagtcgataattttagttttgaaaaaattaaaataaactttttctttttaact 3106191  T
182 caaacggtttaaggttgtgtgattgtattattgaagtgaaaataataatcacaataatgagaagtttaaattgtgaccttttttaaaataaac---taag 278  Q
    |||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||   ||||    
3106192 caaacggtttaaggttgtgtgattg---tattgaagtgaaaataataatcacaataatgagaagtttaaatcgtgactttttttaaaataaactcttaag 3106288  T
279 ttttctttttccttcat 295  Q
    |||||||| ||||||||    
3106289 ttttctttctccttcat 3106305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 65
Target Start/End: Original strand, 3105906 - 3105941
Alignment:
30 gtctctcactcagtttgggtttgcgctttattacgt 65  Q
    |||||||||||| |||||||||||||||||||||||    
3105906 gtctctcactcattttgggtttgcgctttattacgt 3105941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University