View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_68 (Length: 306)
Name: NF1371_low_68
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 82 - 295
Target Start/End: Original strand, 3106092 - 3106305
Alignment:
| Q |
82 |
ttaatgattattgattgtccgattgagatcatataatttaaagttcaaagtcgataattttagttttgaaaaaattaaaataaactttttctttataact |
181 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3106092 |
ttaatgattattgattgtctgattgagatcatataatttaaagttcaaagtcgataattttagttttgaaaaaattaaaataaactttttctttttaact |
3106191 |
T |
 |
| Q |
182 |
caaacggtttaaggttgtgtgattgtattattgaagtgaaaataataatcacaataatgagaagtttaaattgtgaccttttttaaaataaac---taag |
278 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
3106192 |
caaacggtttaaggttgtgtgattg---tattgaagtgaaaataataatcacaataatgagaagtttaaatcgtgactttttttaaaataaactcttaag |
3106288 |
T |
 |
| Q |
279 |
ttttctttttccttcat |
295 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
3106289 |
ttttctttctccttcat |
3106305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 65
Target Start/End: Original strand, 3105906 - 3105941
Alignment:
| Q |
30 |
gtctctcactcagtttgggtttgcgctttattacgt |
65 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3105906 |
gtctctcactcattttgggtttgcgctttattacgt |
3105941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University