View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_72 (Length: 285)
Name: NF1371_low_72
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 44 - 124
Target Start/End: Complemental strand, 8461410 - 8461330
Alignment:
| Q |
44 |
tcataggtaatcatagatgaaagaccataaatttgaagattgatagtccatnnnnnnngaaagcaatgaatttgaagtttg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
8461410 |
tcataggtaatcatagatgaaagaccataaatttgaagattgatagtccataaaaaaagaaaacaatgaatttgaagtttg |
8461330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 223
Target Start/End: Complemental strand, 8461269 - 8461231
Alignment:
| Q |
185 |
cgttattcatccacgatggtaattttgcctctagatatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8461269 |
cgttattcatccacgatggtaattttgcctctagatatt |
8461231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 93
Target Start/End: Original strand, 29560475 - 29560513
Alignment:
| Q |
55 |
catagatgaaagaccataaatttgaagattgatagtcca |
93 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
29560475 |
catagatgaaagaccatatatttgaagattgataatcca |
29560513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University