View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_79 (Length: 271)
Name: NF1371_low_79
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_79 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 38 - 271
Target Start/End: Original strand, 38747304 - 38747537
Alignment:
| Q |
38 |
gtaatatagcttaatccttcaatatttacacttcactccactgataatcaccattttggcaccatcttcaaaattcaacactcttctacatcagcagttc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747304 |
gtaatatagcttaatccttcaatatttacacttcactccactgataatcaccattttggcaccatcttcaaaattcaacactcttctacatcagcagttc |
38747403 |
T |
 |
| Q |
138 |
attaacccatccgagatcaggcgcaggacaagacaaaccattgacgtcaccaccaccaacaaccttattaaggttgtcgttatttcccaaaaacatgttc |
237 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747404 |
attaacccatccgagatcaggggcaggacaagacaaaccattgacgtcaccaccaccaacaaccttattaaggttgtcgttatttcccaaaaacatgttc |
38747503 |
T |
 |
| Q |
238 |
atattgttgttaatgatgttattgtcaacatcat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38747504 |
atattgttgttaatgatgttattgtcaacatcat |
38747537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University