View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_82 (Length: 270)
Name: NF1371_low_82
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 262
Target Start/End: Original strand, 11176236 - 11176480
Alignment:
| Q |
16 |
atcaagtaaaatggttcaattaattggagttgaaccgaatctagcatcgatgctttgggtggattacacagcaggcttgtcacgacgtgatcatttcctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
11176236 |
atcaagtaaaatggttcaattaattggagttgaaccgaatctagcatcgatgctttgggtggattacacagtaggcttgtcacgacgtgatcacttcctt |
11176335 |
T |
|
| Q |
116 |
ttcttctaaaaaattcacttttagacaaccaa-attattttannnnnnnngagcaaatatgagttcctttattgaaattaaacaaataggaaaacatata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11176336 |
ttcttctaaaaaattcacttttagacaaccaattttatttt---ttttttgagcaaatatgagttcctttattgaaattaaacaaataggaaaacatata |
11176432 |
T |
|
| Q |
215 |
ctcctattgtgtttatataagagaaaaataaaagaaaataagttgacc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11176433 |
ctcctattgtgtttatataagagaaaaataaaagaaaataagttgacc |
11176480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 115
Target Start/End: Original strand, 11163112 - 11163180
Alignment:
| Q |
44 |
gttgaaccgaatctagcatcgatgctttgggtggattacacagcaggcttgtcacgacgtgatcatttcctt |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||| | ||||||||| |||||||| ||||||| |
|
|
| T |
11163112 |
gttgaacggaatctagcatcgatgctttgggtgga-tacactg--agcttgtcacaacgtgatcctttcctt |
11163180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University