View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_84 (Length: 263)
Name: NF1371_low_84
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 2245718 - 2245490
Alignment:
| Q |
17 |
cttacaagggttcattaaagaagtgaacgaacttgaaattgaagttgaatttgttgtgtataatgaagggtttagtagagatagagattgatttgaaaat |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2245718 |
cttacaagggttcaccaaagaagtgaacgaacttgaaattgaagttgaatttgttgtgtataatgaaggggttagtagagat------tgatttgaaaat |
2245625 |
T |
 |
| Q |
117 |
gaagacggaacgaatgagccgtttaatcggctttcttcgtagaatttttgtaaaatatctctctggcgaaggtaaacagaggaacctaaaggttcaaaat |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245624 |
gaagaaggaacgaatgagccgtttaatcggctttcttcgtagaatttttgtaaaatatctctctggcgaaggtaaacagaggaacctaaaggttcaaaat |
2245525 |
T |
 |
| Q |
217 |
ttgaacagcccaagaaggttgtgctgtctgtggtg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245524 |
ttgaacagcccaagaaggttgtgctgtctgtggtg |
2245490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University