View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_86 (Length: 263)
Name: NF1371_low_86
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 33185556 - 33185783
Alignment:
| Q |
11 |
cacagaaaggatgagaagagttataaacttcttc---aaaagtatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgaatcaaagagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
33185556 |
cacagaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgcaccaaagagg |
33185655 |
T |
 |
| Q |
108 |
attccccataaccgtataatcttcaagctcaccaggttcttgaagacaaagtggaacgttttcacggaaaggacctgaaggtgaaattggacaaccaggg |
207 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |||||||||| | ||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33185656 |
atttcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccaggg |
33185755 |
T |
 |
| Q |
208 |
tcaccgaaagattgtagcgggaaaatct |
235 |
Q |
| |
|
||| |||| ||||||||||||||||||| |
|
|
| T |
33185756 |
tcagcgaacgattgtagcgggaaaatct |
33185783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University