View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_94 (Length: 252)
Name: NF1371_low_94
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3988424 - 3988203
Alignment:
| Q |
1 |
cttgatccaattttagccgtagatattttaagcatcactctcnnnnnnnnnnnnnngatagagtgcatacacaagcttagtataagaa---ccctcatat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
3988424 |
cttgatccaattttagccgtagatattttaagcatcactctctctatatata----gatagagtgcatacacaagcttaatataagaagaaccctcatat |
3988329 |
T |
 |
| Q |
98 |
taatattagatatcatcaatcaatatttattttagttccaaaatgttagacaaactttgggatgatactgttgctggccctcaacctgagcgtggccttg |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3988328 |
taatattagatattatcaatcaatatttattttagttccaaaatgttagacaaactttgggatgatactgttgctggccctcaacctgagcgtggccttg |
3988229 |
T |
 |
| Q |
198 |
agaagcttaggaaactaactaccagc |
223 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
3988228 |
agaagcttaggaagctaactaccagc |
3988203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University