View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1372-INSERTION-2 (Length: 179)
Name: NF1372-INSERTION-2
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1372-INSERTION-2 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 2e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 7 - 179
Target Start/End: Original strand, 41459429 - 41459601
Alignment:
| Q |
7 |
aataatggatatgcagctcctgaatatgtagattcaggtattttccggttcatgttcccgaaccatatttttgtttcgcgtttctccttttccgannnnn |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41459429 |
aataatggatatgcagctcctgaatatgtagattcaggtattttccggttcatgttcccgaaccatatttttgtttcgcgtttctccttttctgattttt |
41459528 |
T |
|
| Q |
107 |
nnatgttattctagattcagcttagttgtcttgcttaagactaatttatctttattctttgcgagccttgaat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41459529 |
ttatgttattctagattcagcttagttgtcttgcttaagactaatttatctttattctttgcgagccttgaat |
41459601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 41442640 - 41442679
Alignment:
| Q |
11 |
atggatatgcagctcctgaatatgtagattcaggtatttt |
50 |
Q |
| |
|
||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
41442640 |
atggatatgcagctcctgaatatctagctacaggtatttt |
41442679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University