View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1372-INSERTION-6 (Length: 119)
Name: NF1372-INSERTION-6
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1372-INSERTION-6 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 4e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 47460450 - 47460561
Alignment:
| Q |
8 |
gcattgtcatacaaagcagatgaaccgtcttctccaatcatcatttgcgagatttgtgccgaaacaaaaacggctgatgaaatgtttaggaatcagata- |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47460450 |
gcattgtcat-caaagcagatgaaccgtcttctccaatcatcatttgcgagatttgtgccgaaacaaaaacggctgatgaaatgtttaggaatcagatat |
47460548 |
T |
 |
| Q |
107 |
tgttaccattcat |
119 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47460549 |
tgttaccattcat |
47460561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 51 - 119
Target Start/End: Original strand, 47467159 - 47467227
Alignment:
| Q |
51 |
tttgcgagatttgtgccgaaacaaaaacggctgatgaaatgtttaggaatcagatatgttaccattcat |
119 |
Q |
| |
|
|||| ||||||||||| |||||||||||| ||||||||||||| || || | || |||||| ||||||| |
|
|
| T |
47467159 |
tttgtgagatttgtgcggaaacaaaaacgactgatgaaatgttcagaaacctgagatgttatcattcat |
47467227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University