View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13720_high_4 (Length: 416)
Name: NF13720_high_4
Description: NF13720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13720_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 5e-69; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 257 - 409
Target Start/End: Complemental strand, 22898682 - 22898530
Alignment:
| Q |
257 |
tcttcaaggtcgccatacttgaaaaggcgtgccagactctcacgatcttcatcgtactctaatgatcgtacaacatacgaccagttcactcgaaggataa |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22898682 |
tcttcaaggttgccatacttgaaaaggcgtgccagacgctcacgatcttcatcttactctgatgatcgtacaacatacgaccagttcactcgaaggataa |
22898583 |
T |
|
| Q |
357 |
gggaagcttgaatccccactagattggagaaatcccctagatggatacctatg |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22898582 |
gggaagcttgaatccccactagattggagaaatcccccagatggatacctatg |
22898530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 119 - 258
Target Start/End: Complemental strand, 22898897 - 22898758
Alignment:
| Q |
119 |
catcccccattgaaagctcgaaggaggagcccaattgccaaattttgcagccgggagttcttctctgtgaggctccttcctcgttctcgatatacaggag |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22898897 |
catcccccattgaaagctagaaggaggagcccaattgccaaattttgcagccgcgagttcttctctgtgaggctccttcctcgttctcgatatacaggag |
22898798 |
T |
|
| Q |
219 |
ttaggtcaccaactttcaggcaacctgttcgccctccttc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22898797 |
ttaggtcaccaactttcaggcaacctgttcgccctccttc |
22898758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 22899656 - 22899570
Alignment:
| Q |
18 |
ataaacctgttagtttgccccttccattgtgtggggttaccacattttccatgttactttcattaatttagtgagcaattagttctt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22899656 |
ataaacctgttagtttgccccttccattgtgtggggttaccacattttccatgttactttcattaatttagtgagcaattagttctt |
22899570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University