View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13720_low_11 (Length: 201)
Name: NF13720_low_11
Description: NF13720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13720_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 6e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 6e-42
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 22899656 - 22899570
Alignment:
| Q |
18 |
ataaacctgttagtttgccccttccattgtgtggggttaccacattttccatgttactttcattaatttagtgagcaattagttctt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22899656 |
ataaacctgttagtttgccccttccattgtgtggggttaccacattttccatgttactttcattaatttagtgagcaattagttctt |
22899570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 119 - 188
Target Start/End: Complemental strand, 22898897 - 22898828
Alignment:
| Q |
119 |
catcccccattgaaagctcgaaggaggagcccaattgccaaattttgcagccgggagttcttctctgtga |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22898897 |
catcccccattgaaagctagaaggaggagcccaattgccaaattttgcagccgcgagttcttctctgtga |
22898828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University