View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13721_low_11 (Length: 328)
Name: NF13721_low_11
Description: NF13721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13721_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 306
Target Start/End: Complemental strand, 4189602 - 4189312
Alignment:
| Q |
16 |
agcatgaacatgagtccaagtatgagcccacctttccctactgctgcttcaccatctccagcttcttcaccgtcaccttccaccggagaatcaatgtctg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189602 |
agcatgaacatgagtccaagtatgagcccacctttccctactgatgcttcaccatctccagcttcttcaccgtcaccttccaccggagaatcaatgtctg |
4189503 |
T |
 |
| Q |
116 |
ataacccagttgcttcaagtccaagcaacgcggttgttcgcagaagcagctttttcatgctaccattctttgccggtgctgcactgcttcttgcataaac |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4189502 |
ataatccagttgcttcaagtccaagcaacgcggttgttcgcagaagcagctttttcatgctaccattctttgctggtgctgcactgcttcttgcataaac |
4189403 |
T |
 |
| Q |
216 |
aaagttgagagttcttgattcaacttcatgtagaccaagtcacaaagatatgcaatcgtgtatcttattttgttttcctttctagcttcta |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189402 |
aaagttgagagttcttgattcaacttcatgtagaccaagtcacaaagatatgcaatcgtgtatcttattttgttttcctttctagcttcta |
4189312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University