View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13721_low_14 (Length: 266)
Name: NF13721_low_14
Description: NF13721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13721_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 85 - 247
Target Start/End: Original strand, 13669429 - 13669591
Alignment:
| Q |
85 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669429 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
13669528 |
T |
 |
| Q |
185 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669529 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgc |
13669591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University