View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13721_low_17 (Length: 236)
Name: NF13721_low_17
Description: NF13721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13721_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 74 - 218
Target Start/End: Complemental strand, 3848801 - 3848658
Alignment:
| Q |
74 |
tcttggtttttatttgtcttttgtataactcttaatcgttttctaattgtccgttgaattgatactatttctggttgatgtaactttgttttactctttt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3848801 |
tcttggtttttatttgtcttttgtataactcttaatggttttttaattgtccgttgaat-gatactatttctggttgatgtaattttgttttactctttt |
3848703 |
T |
 |
| Q |
174 |
ctgcttcaaggtatcaatgaagatgatgaaaaagacggtgtagat |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3848702 |
ttgctttaaggtatcaatgaagatgatgaaaaagacggcgtagat |
3848658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 3849018 - 3848948
Alignment:
| Q |
12 |
attattctcgttaaagagattttattgtttacaataatactttggatgtgttttaataattgtcttggtttt |
83 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
3849018 |
attactcttgttaaagagattttcttgtttacaataatactttaggtgtgttttaataatt-tcttggtttt |
3848948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 70 - 211
Target Start/End: Complemental strand, 35524247 - 35524113
Alignment:
| Q |
70 |
attgtcttggtttttatttgtcttttgtataactcttaatcgttttctaattgtccgttgaattgatactatttctggttgatgtaactttgttttactc |
169 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| |||| ||||||||||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
35524247 |
attgtcttggtttttatttgtgttatgtataactcctaatgactttctaattgtccattgaattgata-------tggttgatgtaattttgttttactc |
35524155 |
T |
 |
| Q |
170 |
ttttctgcttcaaggtatcaatgaagatgatgaaaaagacgg |
211 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524154 |
ttttttgcttcaaggtatcaatgaagatgatgaaaaagacgg |
35524113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University