View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13721_low_19 (Length: 219)

Name: NF13721_low_19
Description: NF13721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13721_low_19
NF13721_low_19
[»] chr5 (1 HSPs)
chr5 (18-200)||(13669409-13669591)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 13669409 - 13669591
Alignment:
18 caaagggcaataacaaaaaacagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtgg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13669409 caaagggcaataacaaaaaacagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtgg 13669508  T
118 aagcagcagtttctcctcgtactcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13669509 aagcagcagtttctcctcgtactcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgc 13669591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University