View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13721_low_8 (Length: 373)
Name: NF13721_low_8
Description: NF13721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13721_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 352
Target Start/End: Complemental strand, 3155838 - 3155507
Alignment:
| Q |
11 |
cataggcatagtatagcacatcggtaacacttttttgtagtgttaattagatattctttgtgcataattatatataggctaatcaaattctaacgtaaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3155838 |
cataggcatagtatagcacatcggtaacacttttttgtagtgttaattagatattctttgtgcataattatatataggctaatcaaattctaacgtaaga |
3155739 |
T |
|
| Q |
111 |
tattgattaaactnnnnnnngactcgtactatatcatacattatcaacactttaaattgagcaaatctattttttatcaagtaaaaccaatttaacaacc |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3155738 |
tattgattaaactaaaaaaagactcgtactatatcatacattatcaacactttaacttgagcaaatctattttttatcaagtaaaaccaatttaacaatc |
3155639 |
T |
|
| Q |
211 |
acacgttacccttagatccactccattttacattcatttatttagatttgcttttcgttttgtttcnnnnnnncaagtatgcgtcaatttcacgtggtag |
310 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
3155638 |
acacgt----------tccactccattttacgttcatttatttagatttgcttttcgttttgtctcaaaaaaacaagtaagcgtcaatttcacgtggtag |
3155549 |
T |
|
| Q |
311 |
gtttagtcgtgcataccatttgcacatactcattgtcacgta |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3155548 |
gtttagtcgtgcataccatttgcacatactcattgtcacgta |
3155507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University