View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13722_low_10 (Length: 307)
Name: NF13722_low_10
Description: NF13722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13722_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 51507110 - 51506834
Alignment:
| Q |
18 |
ccaatggtataaaacattgttggaagatgattttgaagatcaaatagatgttgatgttattttgggatctttgtacctgaaggatgcagagcaggtattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51507110 |
ccaatggtataaaacattgttggaagatgattttgaagatcaaatagatgttgatgtcattttgggatctttgtacctgaaggatgcagagcaggtattt |
51507011 |
T |
 |
| Q |
118 |
tgaccaaaacttttgcttgtcattagttcttcttctatggaagcagaactagtatcttcctaaggatcctagatttgatattagatcagtgcagattgtt |
217 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51507010 |
tgaacaaaacttttgcttgtcgttagttcttcttctatggaagcagaactggtattttcctaaggatcctagatttgatattagatcagtgcagattgtt |
51506911 |
T |
 |
| Q |
218 |
gaaggcattccaaatgtaactggaattcagcttgatgtgatggatagtgccagtctttttaagagcatttcacaggt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51506910 |
gaaggcattccaaatgtaactggaattcagcttgatgtgatggatagtgccagtctttttaagagcatttcacaggt |
51506834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University