View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13723_high_2 (Length: 235)
Name: NF13723_high_2
Description: NF13723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13723_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 4994819 - 4995024
Alignment:
| Q |
1 |
ttaaatcttgtactgtatcattataataataatttcataaatccagaccagcaattaggcatataaaaatagatagaactggtatctgcccgaattagca |
100 |
Q |
| |
|
|||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4994819 |
ttaaatcttgtactacatcattataacaatcatttcataaatccagaccagcaattaggcatataaaaataga----actggtatctgcccgaattagca |
4994914 |
T |
 |
| Q |
101 |
actttgacggg-aaaattcaaattggctggatttgagtttcgattttcttggattttaaaatatgggacatgttgggtaatggggttagtgatactcacc |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4994915 |
actttgacggggaaaattcaaattggctggatttgagtttggattttcttcgattttaaaatatggggcatgttgggtaatggggttagtgatactcacc |
4995014 |
T |
 |
| Q |
200 |
ctagactcgt |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
4995015 |
ctagactcgt |
4995024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University