View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13723_high_3 (Length: 220)
Name: NF13723_high_3
Description: NF13723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13723_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 27717928 - 27718019
Alignment:
| Q |
123 |
ctcttaatccaattatgtcaaaacgtgcttcaagaggaaaaaaggttccattgctcaagcttttctcctttgctgacttctatgatgatgtc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27717928 |
ctcttaatccaattatgtcaaaacgtgcttcaagaggaaaaaaggttccattgctcaagcttttctcctttgctgacttctatgattatgtc |
27718019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 81 - 115
Target Start/End: Original strand, 27717868 - 27717902
Alignment:
| Q |
81 |
actaatgatatttgcttaattccagttgcagaagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27717868 |
actaatgatatttgcttaattccagttgcagaagc |
27717902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University