View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13723_high_3 (Length: 220)

Name: NF13723_high_3
Description: NF13723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13723_high_3
NF13723_high_3
[»] chr8 (2 HSPs)
chr8 (123-214)||(27717928-27718019)
chr8 (81-115)||(27717868-27717902)


Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 27717928 - 27718019
Alignment:
123 ctcttaatccaattatgtcaaaacgtgcttcaagaggaaaaaaggttccattgctcaagcttttctcctttgctgacttctatgatgatgtc 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
27717928 ctcttaatccaattatgtcaaaacgtgcttcaagaggaaaaaaggttccattgctcaagcttttctcctttgctgacttctatgattatgtc 27718019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 81 - 115
Target Start/End: Original strand, 27717868 - 27717902
Alignment:
81 actaatgatatttgcttaattccagttgcagaagc 115  Q
    |||||||||||||||||||||||||||||||||||    
27717868 actaatgatatttgcttaattccagttgcagaagc 27717902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University