View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13724_high_6 (Length: 462)
Name: NF13724_high_6
Description: NF13724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13724_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 1 - 449
Target Start/End: Complemental strand, 43102218 - 43101767
Alignment:
| Q |
1 |
taattcaaactacttcattcatttatgtctttccatcttcacttggattcgccgtttccacccgtgttggaaacgagctaggtgctaaccgtcctttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102218 |
taattcaaactacttcattcatttatgtctttccatcttcacttggattcgcagtttccacccgtgttggaaacgagctaggtgctaaccgtcctttcca |
43102119 |
T |
 |
| Q |
101 |
agctaagttatcat-ccctgg-tggcaattttcgtt-gctgtaattataggtttctcagcgacgatttttgccacagggatgaggtttcgttggggaaga |
197 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43102118 |
agctaagttatcatgccctggctggcaattttcgtgagctgtaattataggtttctcagacacggtttttgccacagggatgaggtttcgttggggcaga |
43102019 |
T |
 |
| Q |
198 |
atgtttactgcagatgaaaatattcttcggctgacttctttggcacttccaatccttggattgtgtgaacttggtaactgtcctcagacggtgggttgcg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102018 |
atgtttactgcagatgaaaatattcttcggctgacttctttggcacttccaatccttggattgtgtgaacttggtaactgtcctcagacggtgggttgcg |
43101919 |
T |
 |
| Q |
298 |
gtgttgttaggggaacagctaggccaggtgtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtacttgcgttttg |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43101918 |
gtgttgttaggggaacagctaggccaggtgtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtgcttgcgttttg |
43101819 |
T |
 |
| Q |
398 |
gtttgacgttgggtttcgtgggctttggttgggtttgctctcggcacaggtt |
449 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43101818 |
gtttgacgttgggtttcgtgggctttggttgggtttgctctcggcccaggtt |
43101767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 430
Target Start/End: Original strand, 33949540 - 33949715
Alignment:
| Q |
255 |
ggattgtgtgaacttggtaactgtcctcagacggtgggttgcggtgttgttaggggaacagctaggccaggtgtggcggcgaatgtgaaccttggtgctt |
354 |
Q |
| |
|
||||||||||| || || |||||||| || ||||| ||||| |||||||| | || || || ||||| |||||||| |||||||| | |||||| |
|
|
| T |
33949540 |
ggattgtgtgagctaggaaactgtccgcaaacggttggttgtggtgttgtccgagggacggcgaggccgaaagtggcggcaaatgtgaatttgagtgctt |
33949639 |
T |
 |
| Q |
355 |
tctatatggtggggatgccaatggcggtagtacttgcgttttggtttgacgttgggtttcgtgggctttggttggg |
430 |
Q |
| |
|
| ||||||||||| |||||| |||| || | ||||| ||||||||||| |||| ||| | |||||||||||||| |
|
|
| T |
33949640 |
tttatatggtgggaatgccagtggcagttgggcttgctttttggtttgattttggattttgcgggctttggttggg |
33949715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University