View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13724_high_9 (Length: 358)
Name: NF13724_high_9
Description: NF13724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13724_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 346
Target Start/End: Original strand, 36449119 - 36449447
Alignment:
| Q |
18 |
gaaagtggacttgagaggggtgttgaggtgattggtgttttggcgaaatgcaaggaagggagggagcaattggagagttatggtggttgtgcgaagattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36449119 |
gaaagtggacttgagaggggtgttgaggtgattggtgttttggcgaaatgcaaggaagggagggagcaattggagagttatggtggttgtgcgaagattt |
36449218 |
T |
 |
| Q |
118 |
tggtgagtgttttgaggaatggaagttcaagagggattcaatatgcattgttggcacttacttttgtttgtttgcatagcaaggaaatacttatgatgac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36449219 |
tggtgagtgttttgaggaatggaagttcaagagggattcaatatgcattgttggcacttactttggtttgtttgcatagcaaggaaatacttatgatgac |
36449318 |
T |
 |
| Q |
218 |
tctgcaagaaggggttttggaaatttgtattgggatggtagaggatgatagtgagaaagttaggagaaatgcgtctaatttgattcgggttcttcgcgga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36449319 |
tctgcaagaaggggttttggaaatttgtattgggatggtagaggataatagtgagaaagttaggagaaatgcgtctaatttgattcgggttcttcgcgga |
36449418 |
T |
 |
| Q |
318 |
ggaaaccaccaccggatcagttgatgatg |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
36449419 |
ggaaaccaccacaggatcagttgatgatg |
36449447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University