View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13724_low_12 (Length: 269)
Name: NF13724_low_12
Description: NF13724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13724_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 7 - 231
Target Start/End: Complemental strand, 39987182 - 39986958
Alignment:
| Q |
7 |
gttgatagtattataagtagtgtttggagtagtgatattagtagtggaagcataaggataagtataatagtgttgtttagaagaagatgaggataaatct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39987182 |
gttgatagtattataagtagtgtttggagtagtgatagtagtagtggaagcataaggataagtataatagtgttgtttagaagaagatgaggataaatct |
39987083 |
T |
 |
| Q |
107 |
tcatcattgttgttattatgatccatgtaataaaagttgttgaagcattcttcgtcttcttcttgttggttgtaataatgatatgttgtttgtcttgagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39987082 |
tcatcattgttgttattatgatccatgtaataaaagttgttgaagcattcttcgtcttcttcttgttggttgtaataatgatatgttgtttgtcttgagg |
39986983 |
T |
 |
| Q |
207 |
atctagagctgctagaagttgttaa |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39986982 |
atctagagctgctagaagttgttaa |
39986958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University