View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13725_high_18 (Length: 237)
Name: NF13725_high_18
Description: NF13725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13725_high_18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 42038323 - 42038104
Alignment:
| Q |
18 |
taaagcaaatctgaaagagaggtgtgcggttgtgtcagatttagtattattctgaaataagcatgttagaatctgattcttcaaatttgtagaannnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038323 |
taaagcaaatctgaaagagaggtgtgcggttgtgtcagatttagtattattctgaaataagcatgttagaatctgattcttcaaatttgtagaatttttt |
42038224 |
T |
|
| Q |
118 |
ngtcacgtaatgtaaaaacagaatatcagctcaacaaatgaagaaatatcttaccttcaattattgttttgacagtagaacgttgaaataatgaaatgta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038223 |
tgtcacgtaatgtaaaaacagaatatcagctcaacaaatgaagaaatatcttaccttcaattattgttttgacagtagaacgttgaaataatgaaatgta |
42038124 |
T |
|
| Q |
218 |
atatagaattctcaaccggg |
237 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
42038123 |
atatagaattctaaaccggg |
42038104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University