View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13725_high_21 (Length: 228)
Name: NF13725_high_21
Description: NF13725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13725_high_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 11491617 - 11491838
Alignment:
| Q |
7 |
acatcatcatcatcattaagtacaacagttagaaccagtgttttcttcaggtttgccaagattgaatcgtcaacgagctttttgttgagaaacatgttca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11491617 |
acatcatcatcatcattaagtacaacagttagaacctgtgttttcttcaggtttgccaagattgaatcgtcaacgagctttttgttgagaaacatgttca |
11491716 |
T |
 |
| Q |
107 |
tgaactcactagaaaccagcgtgtaaaagacagcagaagctggtgttttgtaaagagcaagttacgattgtgatgtcacaacaaatactaaaatgcaagt |
206 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11491717 |
tgaactcactagaaatcagcatgtaaaagacagcagaagctggtgttttttaaagagcaagttacgattatgatgtcacaacaaatactaaaatgcaagt |
11491816 |
T |
 |
| Q |
207 |
ggtataacaaattctgcttctc |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11491817 |
ggtataacaaattctgcttctc |
11491838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University