View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13727_high_4 (Length: 377)

Name: NF13727_high_4
Description: NF13727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13727_high_4
NF13727_high_4
[»] chr3 (1 HSPs)
chr3 (1-323)||(48153957-48154285)
[»] chr1 (1 HSPs)
chr1 (85-232)||(4109283-4109427)


Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 48153957 - 48154285
Alignment:
1 aagggactccaagccaccgatgcagataccgccgatgaaagcagccggagtgagagagtgatcggaggtggtggggacggcggggatctcgttgtcatcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48153957 aagggactccaagccaccgatgcagataccgccgatgaaagcagcgggagtgagagagtgatcggaggtggtggggacggcggggatctcgttgtcatcc 48154056  T
101 aattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaagatgatgacagggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48154057 aattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaagatgatgacagggt 48154156  T
201 gttctgatatgaggcggttgattcgagtttctatggattcgtctatgtccatggatagagaagatgaagagggt------gagttggacatgatggtaga 294  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||    
48154157 gttctgatatgaggcggttgattcgagtttctgtggattcgtctatgtccatggatagagaagatgaagagggtgagttggagttggacatgatggtaga 48154256  T
295 agcagtgaggttgaggacggttttgcagc 323  Q
    |||||||||||||||||||||||||||||    
48154257 agcagtgaggttgaggacggttttgcagc 48154285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 85 - 232
Target Start/End: Complemental strand, 4109427 - 4109283
Alignment:
85 gatctcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtg 184  Q
    |||||||||||| || |||| ||| |||||||||| ||| || |||||| |||| || ||| |||||||||| ||||||||||   | ||||| || |||    
4109427 gatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagc---aagaggaacgtgtg 4109331  T
185 aagatgatgacagggtgttctgatatgaggcggttgattcgagtttct 232  Q
    |||||||| || || |||||||||||||| |||| ||| || ||||||    
4109330 aagatgataactggatgttctgatatgagacggtggatgcgtgtttct 4109283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University