View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13727_low_11 (Length: 306)
Name: NF13727_low_11
Description: NF13727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13727_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 294
Target Start/End: Original strand, 3099111 - 3099408
Alignment:
| Q |
16 |
ttttacactcacaacttgccccacattgtaatcactaatcacaccctaacccatgtgcacccctcttttttcttatcttctcctctctataaatctcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3099111 |
ttttacactcacaacttgccccacattgtaatcactaatcacaccctaacccatgtgcacccctcttttttcttatcttctcctctctataaatctcatt |
3099210 |
T |
 |
| Q |
116 |
cctcaaacccctctccctccatctc----------cataacacagaacttcttttacc---------tcaaaaacatactcaaataccataaatacccct |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3099211 |
cctcaaacccctctccctccatctccataacacaacataacacagaactttttttacctcaaaaatatcaaaaacatactcaaataccataaatacccct |
3099310 |
T |
 |
| Q |
197 |
ttcatctcctttattcaagtttcaatctttcacctcagaatctcttttttcttcaattctagttaatgggttgttgctaaattctcttttaatcttca |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3099311 |
ttcatctcctttattcaagtttcaatctttcacctcaaaatctcttctttcttcaattctagttaatgggttgttgctaaatcctcttttaatcttca |
3099408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University