View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13727_low_12 (Length: 289)
Name: NF13727_low_12
Description: NF13727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13727_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 119 - 217
Target Start/End: Original strand, 52262179 - 52262277
Alignment:
| Q |
119 |
taacaatagatccacacaatatagtcttgttcttctctaatatgaatgactagtaataagtcatagctaaaatattgaaatcatttgacataacagaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52262179 |
taacaatagatccacacaatatagtcttgttcttctctaatatgaatgactagtaataagtcatagctaaaatattgaaatcatttgacataatagaaa |
52262277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 52262113 - 52262173
Alignment:
| Q |
16 |
atggaaagtcgtgagttcaaatccgcgcccttgtaaactgatgtctccatcaaataaacta |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52262113 |
atggaaagtcgtgagttcaaatccgcgcccttgtaaacagatgtctccatcaaataaacta |
52262173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 204 - 289
Target Start/End: Original strand, 52250584 - 52250673
Alignment:
| Q |
204 |
tgacataacagaaaacataaa----cctatagaaaagtattgccagcacggccacgatgcaacaagtcatgagcaatattatccctagct |
289 |
Q |
| |
|
||||||||||||||||||||| | |||| ||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52250584 |
tgacataacagaaaacataaaaaaacttataaaaaagtattgccaacacgaccacgatgcaacaaatcatgagcaatattatccctagct |
52250673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University