View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13728_low_1 (Length: 511)
Name: NF13728_low_1
Description: NF13728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13728_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 4e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 4e-98
Query Start/End: Original strand, 68 - 292
Target Start/End: Complemental strand, 21128538 - 21128313
Alignment:
| Q |
68 |
gggttgtaactgtattcaatggaaagagaagcgtgttgaaatgttttcaccggacaatcaaacatacacttcttcgtttttgtttaatcttaaataaaaa |
167 |
Q |
| |
|
|||||||||| || || ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21128538 |
gggttgtaaccgtgtttaatgggaagagaagcgtgttgaaatgttttcatcggacaatcaaacatacacttctttgtttttgtttaatcttaaataaaaa |
21128439 |
T |
|
| Q |
168 |
tattgtttgatataaagtgtaattgtaaatgatgtagtttaggtatgaag-cattaatgagtatatactcaaagtttctctttagcatattataactcaa |
266 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21128438 |
tattgtttgacataaagtgtaattgtaaatgatgtagtttagatatgaagacattaatgagtatatactcaaagtttctctttagcatattataactcaa |
21128339 |
T |
|
| Q |
267 |
tgaaacataatatcataatgagtatt |
292 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
21128338 |
tgaaatataatatcataatgagtatt |
21128313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 349 - 390
Target Start/End: Complemental strand, 21128304 - 21128263
Alignment:
| Q |
349 |
taaggcgtatctagtgtctatacgtggacaaagacacggcac |
390 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
21128304 |
taaggcatatctagtgtatatacgtggacaaagacacggcac |
21128263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University