View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13728_low_11 (Length: 256)
Name: NF13728_low_11
Description: NF13728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13728_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 4405499 - 4405720
Alignment:
| Q |
18 |
acagaatcaaaacattgtttctacaggtttaggtttatcctttggtgatcaacaacatcaaagactacaattgctnnnnnnnnnnnnnnnnnntgggtgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4405499 |
acagaatcaaaacattgtttctacaggtttaggtttatcctttggtgatcaacaacatcaaagactacaattgctacaacaacaaca---------gtgt |
4405589 |
T |
|
| Q |
118 |
cattcctctcatttcttgtctctattgtcaaatggtttagcttcacaaatcaaacaacaaaaggatgaaattgaccaattccttcaagcccaggtacaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405590 |
cattcctctcatttcttgtctctattgtcaaatggtttagcttcacaaatcaaacaacaaaaagatgaaattgaccaattccttcaagcccaggtacaat |
4405689 |
T |
|
| Q |
218 |
tcttccatatgttaacaatttctggattagt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4405690 |
tcttccatatgttaacaatttctggattagt |
4405720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University