View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13729_high_10 (Length: 243)
Name: NF13729_high_10
Description: NF13729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13729_high_10 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 41 - 243
Target Start/End: Complemental strand, 35520421 - 35520218
Alignment:
| Q |
41 |
atcaactttttattagaagataatcaaacaatgttgtttatctatttataaggatgtctatgttgcatgttagttccgtcttttattgaatatcttgtga |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
35520421 |
atcaactttttattagaagataatcaaacaatgttgtttatctgattataaggatgtctatgttgcatgttagttccgtcttttattgaacatctggtga |
35520322 |
T |
|
| Q |
141 |
atatcaattaaaaaatattaaatttggaaaatggtcgcctaattagaga-ggacacttcattgttagtaaggttcatagtgaaagaacctattatcggct |
239 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520321 |
attgcaattaaaaaatattaaatttggaaaatggtcgcctaattagagagggacacttcattgttagtaaggttcatagtgaaagaacctattatcggct |
35520222 |
T |
|
| Q |
240 |
ccat |
243 |
Q |
| |
|
|||| |
|
|
| T |
35520221 |
ccat |
35520218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 11 - 50
Target Start/End: Complemental strand, 35524028 - 35523989
Alignment:
| Q |
11 |
catcatcatcacctctgccaaatcaaccgtatcaactttt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524028 |
catcatcatcacctctgccaaatcaaccgtatcaactttt |
35523989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University