View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13729_high_13 (Length: 229)
Name: NF13729_high_13
Description: NF13729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13729_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 3359451 - 3359251
Alignment:
| Q |
19 |
ggggagttatttaatgtttagacctcattaattaaataaattttttaatcttcattgtctcctgtacaatgtttataacattatataatttatttgcata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3359451 |
ggggagttatttaatgtttagacctcattaattaaatagattttttaatcttcattgtctcctgtacaatgtttataacatattataatttatttgcata |
3359352 |
T |
 |
| Q |
119 |
tacttttaatgatttctcacaatacgtgttactgatga------nnnnnnnnnnaccatattattgtagtatatgtatccctaatttgcagcgatcgttt |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3359351 |
tacttttaatgttttctcacaatacgtgttactgatgattttttttttttttttaccatattattgtagtatatgtatccctaatttgcagcgatcgttt |
3359252 |
T |
 |
| Q |
213 |
t |
213 |
Q |
| |
|
| |
|
|
| T |
3359251 |
t |
3359251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University