View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13729_low_11 (Length: 248)
Name: NF13729_low_11
Description: NF13729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13729_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 11402574 - 11402333
Alignment:
| Q |
1 |
tttatatcttcaatcgtctgctttgcgctcaaacttttcgcggtgaaaacataatttctcctctcttggttgtaataacttcttcctttgccatatatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402574 |
tttatatcttcaatcgtctgctttgcgctcaaacttttcgcggtgaaaacataatttctcctctcttggttgtaataacttcttcctttgccatatataa |
11402475 |
T |
 |
| Q |
101 |
ttgatagaaccaaaattgtttccaccttttggattgaaattgttctctcttttgatcgaagtttccatgtcctctcccatttgattggattcattaatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
11402474 |
ttgatagaaccaaaattgtttccaccttttggattgaaattgttctctcttttgatcgaagttttcatgtcctctcccatttgattggattcattaatgt |
11402375 |
T |
 |
| Q |
201 |
tattgaagttcacttgacttttcaaggcttcctcctatgctt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11402374 |
tattgaagttcacttgacttttcaaggcttcctcctttgctt |
11402333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University