View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13729_low_9 (Length: 299)
Name: NF13729_low_9
Description: NF13729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13729_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 283
Target Start/End: Original strand, 51306211 - 51306278
Alignment:
| Q |
216 |
atggtgattgttttatcgctggatttgggtgaggaaagaaaaacagattggagagttctagatacaag |
283 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51306211 |
atggtgattgttgtatcgctggatttgggtgaggaaagaaaaacagagtggagagttctagatacaag |
51306278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University