View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1372_low_17 (Length: 344)
Name: NF1372_low_17
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1372_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 168
Target Start/End: Original strand, 53842030 - 53842180
Alignment:
| Q |
18 |
gtaaatggattaggaagctaaatgtgtaacaaataatggattattattattattttctcctttttacgttaccatcctaaataaactttctgaatgacag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842030 |
gtaaatggattaggaagctaaatgtgtaacaaataatggattatcattattattttctcctttttacgttaccatcctaaataaactttctgaatgacag |
53842129 |
T |
 |
| Q |
118 |
atgatgacaaagaaaagtagttccatcgaacaccaaacatgaaagaatgac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53842130 |
atgatgacaaagaaaagtagttccatcgaacaccaaacatgaaaaaatgac |
53842180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 261 - 315
Target Start/End: Original strand, 53842272 - 53842326
Alignment:
| Q |
261 |
gggaaatagtcatttatacctgaattccgttaggcgagttctgcgccgtgagaac |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842272 |
gggaaatagtcatttatacctgaattccgttaggcgagttctgcgccgtgagaac |
53842326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University