View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1372_low_19 (Length: 330)
Name: NF1372_low_19
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1372_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 21 - 301
Target Start/End: Original strand, 11063088 - 11063368
Alignment:
| Q |
21 |
caagaattaaagatcaacaaccttttggacataattactaggtaagagtcatcctacttaatcagcttggttgccatttactgtttatacttctttttgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11063088 |
caagaattaaagatcaacaaccttttggacataattactaggtaagagtcatcctacttaatcagcttggttgccctttactgtttatacttctttttgt |
11063187 |
T |
 |
| Q |
121 |
ttgaactaagttgccattccatatatgtttttatcccttattttgtttttgggcaactttccttatatgctagtcttggggcatttaaaactaatgatta |
220 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11063188 |
ttgaactaagttgccattccatatatatgtttatcccttattttgtttttgggcaactttccttttatgctagtcttggggcatttcaaactaatgatta |
11063287 |
T |
 |
| Q |
221 |
actatcaaagttcttgcatttccctcgagtgattatcaacaatcaacatctttcctcaaaggagaaccttattgttagaac |
301 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11063288 |
actatcaaagttcttgcatttccctcgaatgattatcaacaatcaacatctttcctcaaaggagaaccttattgttagaac |
11063368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University