View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1372_low_25 (Length: 320)
Name: NF1372_low_25
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1372_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 44 - 236
Target Start/End: Complemental strand, 113132 - 112940
Alignment:
| Q |
44 |
actatagtataggtaatctgttgctaatcattcttttaacaaaatatttgttaatgagtttacccacggtcaagccctgtgaaaggtatgtgattgttga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113132 |
actatagtataggtaatctgttgctaatcattcttttaacaaaatatttgttaatgagtttacccacggtcaagccctgtgaaaggtatgtgattgttga |
113033 |
T |
 |
| Q |
144 |
gtattttacccacaactaagccttcggtaatataaaataaaaaattgacataatatttcatctataatgcaaaaattatgaagattatgcatc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113032 |
gtattttacccacaactaagccttcggtaatataaaataaaaaattgacataatatttcatctataatgcaaaaattatgaagattatgcatc |
112940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University