View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1372_low_28 (Length: 297)
Name: NF1372_low_28
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1372_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 66 - 245
Target Start/End: Complemental strand, 24505847 - 24505669
Alignment:
| Q |
66 |
agattttaggttctttatttattcccctggtcagggccaccattgagaaaattcccctgataaacactaataaggaggataccctcatgtggatgcatga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24505847 |
agattttaggttctttatttattcccctggacagggccaccattgagaaaattcccctgataaacactaataaggaggataccctcatgtggatgcatga |
24505748 |
T |
|
| Q |
166 |
accgaacggaaactatacgggttaaaagtggttacaaggctatccaaatttggaaaactcaagctatcaacactctctct |
245 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
24505747 |
accgaacggaaactatac-ggttaaaagtggttacaaggctatccaagtttggaaaactcaagctatcaacactccctct |
24505669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University