View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1372_low_29 (Length: 293)
Name: NF1372_low_29
Description: NF1372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1372_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 42 - 225
Target Start/End: Original strand, 42765458 - 42765641
Alignment:
| Q |
42 |
agataattctatgtcaaatttatacaagaaatctttctagcaaacacattatgtccttaaaccgtatttaacactaatgttttgaggcaatttcttcgtt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42765458 |
agataattctatgtcaaatttatacaagaaatctttctagcaaacacattatgtccttaaaccgtatttaacactaatgttttgaggcaatttcttcgtt |
42765557 |
T |
|
| Q |
142 |
tgcaacattaatgaagttgtactcccgttagaattgtttgcatggtcttgtttttaatttgtcgagcacattggtacggatgca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42765558 |
tgcaacattaatgaagttgtactcccgttagaattgtttgcatggtcttgtttttaatttgtcgagcacattggtacggatgca |
42765641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 42758767 - 42758822
Alignment:
| Q |
1 |
atgagtcattgtaaaaatctttctcttcattatgtcaatttagataattctatgtc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42758767 |
atgagtcattgtaaaaatctttctcttcattatgtcaatttagataattctatgtc |
42758822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 144
Target Start/End: Original strand, 14579158 - 14579192
Alignment:
| Q |
110 |
taacactaatgttttgaggcaatttcttcgtttgc |
144 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
14579158 |
taacacgaatgttttgaggcaatttcttcgtttgc |
14579192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University