View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373-INSERTION-2 (Length: 165)
Name: NF1373-INSERTION-2
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373-INSERTION-2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 45108410 - 45108563
Alignment:
| Q |
8 |
gttgtgacgtaaattagaatggcttgatgaagaaatactgggaaagaggacctgaatggactcccttcggtctcatgttttccccatatgccatgggaga |
107 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45108410 |
gttgtgacataaattagaatgacttgatgaagaaatactgggaaagaggacctgaatggactcccttcggactcatgttttccccatatgccatgggaga |
45108509 |
T |
|
| Q |
108 |
gaatattaggcggggtggaaatgcaaacattatagttcagaagattagaattaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45108510 |
gaatattaggcggggtggaaatgcaaacattatagtttagaagattagaattaa |
45108563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University