View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13730_low_4 (Length: 209)
Name: NF13730_low_4
Description: NF13730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13730_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 23 - 193
Target Start/End: Original strand, 2833574 - 2833744
Alignment:
| Q |
23 |
gattggatgattttgaagtccctaacccatccctagcttaacccgataatttatgcctcatgttggactggatttaagacaaaatcgagttggcttgaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833574 |
gattggatgattttgaagtccctaacccatccctagcttaacccgataatttatgcctcatgttggactggatttaagacaaaatcgagttggcttgaaa |
2833673 |
T |
 |
| Q |
123 |
tacatttacaacgtttttaatgactttactacacacacatccctaataaatctcattttataagtcattaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833674 |
tacatttacaacgtttttaatgactttgctacacacacatccctaataaatctcattttataagtcattaa |
2833744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University