View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13731_high_14 (Length: 236)
Name: NF13731_high_14
Description: NF13731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13731_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 2 - 199
Target Start/End: Original strand, 6182854 - 6183048
Alignment:
| Q |
2 |
tgtttaattaaagggcgaacaaggtgttttatttgagaatcgagaaggtgaagaaatggtgaacaacaatggatgactagccaagaaatttgactagtgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6182854 |
tgtttaattaaagggcgaacaaggtgttttatttgagaatcgagaaggtgtagaaatggtgaacaacaatggatgactacccaagaaatttgactagtgt |
6182953 |
T |
 |
| Q |
102 |
aacacggggattcctcatacttgtgtctcaaagtaaggggagnnnnnnnnatctataatagtattatattttggactgtttctaaaataaaataaaaa |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6182954 |
aacacagggattcctcatacttgtgtctcaaagtaaggagagttttttttatctataa---tattatattttggactgtttctaaaataaaataaaaa |
6183048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 6183048 - 6183092
Alignment:
| Q |
176 |
actgtttctaaaataaaataaaaagtaggttggtaaaggttattt |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6183048 |
actgtttccaaaataaaataaaaagtaggttggtaaaggttattt |
6183092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University