View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13731_low_10 (Length: 337)
Name: NF13731_low_10
Description: NF13731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13731_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 92 - 285
Target Start/End: Complemental strand, 42679501 - 42679306
Alignment:
| Q |
92 |
acatttgatcaagggacgctatatagtcggtggctgtacatattcctgaagcagaaaatatcgcgtgttactatcccgatata--aattcataaagatgt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42679501 |
acatttgatcaagggacgctatatagtcggtggctgtacatattcctgaagcagaaaatatcgcgtgttactatcccgatatataaattcataaagatgt |
42679402 |
T |
 |
| Q |
190 |
gttcaagacctattggtgttgctggacatattattcctaggaatttcccatcactaacgcgtaggtggtaaggttaaagaaaatcgtgttcgttag |
285 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42679401 |
gttcaaaacctattggtgttgctggacatattattcctaggaatttcccatcactaatgcttaggtggtaaggttaaagaaaatcgcgttcgttag |
42679306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 71
Target Start/End: Complemental strand, 42679581 - 42679519
Alignment:
| Q |
9 |
tcgagagagaagaaagaattgtatagaatgtatnnnnnnnngttgttgcgtgaaaggttatag |
71 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
42679581 |
tcgagaaagaagaaagaattgtatagaatgtataaaaaaaagtggttgcgtgaaaggttatag |
42679519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University