View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13731_low_12 (Length: 310)
Name: NF13731_low_12
Description: NF13731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13731_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 164 - 297
Target Start/End: Original strand, 35202593 - 35202726
Alignment:
| Q |
164 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202593 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
35202692 |
T |
 |
| Q |
264 |
ttcaattctacaagagtttcaagttcttcttctg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35202693 |
ttcaattctacaagagtttcaagttcttcttctg |
35202726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 14 - 137
Target Start/End: Original strand, 35202449 - 35202572
Alignment:
| Q |
14 |
tggtggtggttgcagaaaaaacaaacgtcttaaacgaccaaatcactcctcttcaaatattgatactgctactgcttctccttcttcttcaactcctact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35202449 |
tggtggtggttgcagaaaaaacaaacgtcttaaacgaccaaatcactcttcttcaaatattgatactgctactgcttctccttcttcttcaactcctaat |
35202548 |
T |
 |
| Q |
114 |
agtgctaattcaaaccctccttct |
137 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35202549 |
agtgctaattcaaaccctccttct |
35202572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University