View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13731_low_18 (Length: 236)
Name: NF13731_low_18
Description: NF13731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13731_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 7067680 - 7067893
Alignment:
| Q |
1 |
caacccatgtttgaaaatcaaactgcacaacaagaacaacaaaactgaatcgtnnnnnnn--tgcaattttaggtgaaaattacaatcttataagcttct |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067680 |
caacccatgtttgaaaatcaaactacacagcaagaacaacaaaactgaatcttaaaaaaaaatgcaattttaggtgaaaattacaatcttataagcttct |
7067779 |
T |
 |
| Q |
99 |
gaaactcagcattgtacttcaaagaacatgaacaaaccctagaagcaaaatcaggaaaagggtagtagagggtgaaagttaagattttgaggttggaatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7067780 |
gaaactcagcattgtacttcaaagaacatgaacaaaccctagaagcaaaatcaggaaaagggtagtagaggatgaaagttaagattttgaggttggaatt |
7067879 |
T |
 |
| Q |
199 |
gtgatcagagagtg |
212 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7067880 |
gtgatcagagagtg |
7067893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University