View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13732_high_13 (Length: 344)
Name: NF13732_high_13
Description: NF13732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13732_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 86 - 332
Target Start/End: Complemental strand, 5103525 - 5103279
Alignment:
| Q |
86 |
gagaagaagaaggtggtttattctcctcttccttcaaactatgttactctcgctcagcttcaagagcgttggttgaagcaacaaagtgnnnnnnntcaac |
185 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5103525 |
gagaagaagaaggtagtttattctcctcttccttcaaactatgttactctcgctcagcttcaagagcgttggttgaagcaacaaagtgaaaaaaatcaac |
5103426 |
T |
|
| Q |
186 |
aagnnnnnnnggaggatcatcaaccagtggatgagcgacacgtggtggttgtggctgaaacgagtgtaaccgtttctaggtctaatccggttgatcgaac |
285 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5103425 |
aagaaaaaaaggaggatcatcaaccagtggatgagcgacacgtggtggttgtggctgaaacgagtgtaaccgtttctaggtctaatccgtttgatcgaac |
5103326 |
T |
|
| Q |
286 |
tcgcgatgactcggtagataaccgtcgtgtggtgcatgttgctgttg |
332 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
5103325 |
tcgcgatgactcggtggataaccgtcgtgtggtggatgttgctgttg |
5103279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University