View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13732_high_5 (Length: 480)
Name: NF13732_high_5
Description: NF13732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13732_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 8e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 233 - 463
Target Start/End: Original strand, 4006151 - 4006383
Alignment:
| Q |
233 |
ctatcacattaaaaaattatcaacatatttgttttcccgtcagttataaacatattgaaattaatacaatcacatacacacaaaaca-gtnnnnnnnnn- |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||||| || |
|
|
| T |
4006151 |
ctatcacattaaaaaattatcaacatatttgttttcc-gtcagttataaacatattgaaattagtacaatcatatacacacaaaacaagtaaaaaaaaaa |
4006249 |
T |
|
| Q |
331 |
-ctgcattcaaacatgacctgctcgaattcctacacatgttttatcgttcgatgttcgactagtaaacgttaaccaattaatccaatgtccacaatgcgg |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4006250 |
actgcattcaaacatgacctgctcgaattcctacacatgttttatctttcgatgttcgactagtaaacgttaaccaattaatccaatgtccacaatgcgg |
4006349 |
T |
|
| Q |
430 |
tgaacatgcttctcaaataagattatctccaatt |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4006350 |
tgaacatgcttctcaaataagattatctccaatt |
4006383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 158; E-Value: 7e-84
Query Start/End: Original strand, 23 - 200
Target Start/End: Original strand, 4004871 - 4005048
Alignment:
| Q |
23 |
agcactattgctcctcttcactatctacttctattgtattctaatttctatgtatgtttgccatgatttggttgaaacatcaaagtgtaatttttgcaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4004871 |
agcactattgctcctcttcactatctacttctattgcattctcatttctatgtatgtttgccatgatttggttgaaacttcaaagtgtaatttttgcaaa |
4004970 |
T |
|
| Q |
123 |
attatgatagctcgttgtacttccatagatccaaacatgcacttggacactctaccattgtcaccaaacaccctccac |
200 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4004971 |
attatgatagctccttgtgcttccatagatccaaacatgcacttggacactctaccattgtcaccaaacaccctccac |
4005048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University