View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13733_high_12 (Length: 321)
Name: NF13733_high_12
Description: NF13733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13733_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 69 - 281
Target Start/End: Original strand, 43224465 - 43224677
Alignment:
| Q |
69 |
tatcgaaaggggtttctttttatttggtacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaacagtagaattgtgaccatcaatg |
168 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43224465 |
tatcgaaaggggtttctttttatttggcacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaactgtagaattgtgaccatcaatg |
43224564 |
T |
 |
| Q |
169 |
agaattttggggatatcaaggttatgtcatggaagtagagtttgtgtagattgaaatggtcaccttgtctcttttacgagtgatgttgggatcctggcga |
268 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
43224565 |
aaatttttggggatatcaaggttatgtcatggaagtagagtttgtgtagattgaaatggtcaccttgtctcttttatgagtgatgttgggatcccggcga |
43224664 |
T |
 |
| Q |
269 |
ttgtaatagcttg |
281 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43224665 |
ttgtaatagcttg |
43224677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University