View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13733_low_15 (Length: 288)
Name: NF13733_low_15
Description: NF13733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13733_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 10 - 269
Target Start/End: Complemental strand, 46574426 - 46574178
Alignment:
| Q |
10 |
attatactcatggaagatgatatcaccaggtaagggttttacgnnnnnnngtttcacgtacatcttggtatcttatgtttgttgtaattgactccaaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46574426 |
attatactcatggaagatgatatcaccaggtaagggtttt-------tacgttt----tacatgttggtatcttacgtttgttgtaattgactccaaatt |
46574338 |
T |
|
| Q |
110 |
ttagtctaagcaaacaaatgttggtcgttggtaaattgttagagagaaaaataaaatgttgaattttgaaaatctaacccataatctccattttaactct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46574337 |
ttagtcttagcaaacaaatgttagtcgttggtaaattgttagagagaaaaataaaatgttgaatttcgaaaatctaacccataatctccattttaactct |
46574238 |
T |
|
| Q |
210 |
cctttaacattcatagttcaccaactgagctacaaacgcaggataatttgtgattcatac |
269 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46574237 |
cctttaatgttcatagttcgccaactgagctacaaacgcaggataatttgtgattcatac |
46574178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University